Prev. | 

RIKEN DNA Bank Human Resource - CCDC189

Gene ID NCBI Gene 90835 |  KEGG hsa:90835
Gene Symbol CCDC189
Protein Name coiled-coil domain containing 189
Synonyms C16orf93
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016944 IRAK042F24 pCMV-SPORT6 BC042548 NM_001014979 Full/var
HGX054045 IRAK135B21 pCMV-SPORT6 BC063391 NM_001014979 Partial/var
HGX066599 IRAK166I07 pCMV-SPORT6 BC073881 NM_001014979

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR322806 RBb07A06 pKA1U5 NM_001014979.1  
GGCTGCTTGGGCGAGGAGAGGCAGGGGTGTGTGACCCCGGTGGTTACTGTGCTCGCGTAG
HKR329324 RBb23F04 pGCAP1 NM_001014979.1  
GTGTTCCAGCCTGGAGGACAGCACCGGCCCTCGTATTAGCAACCTGGAAGAGAGGGCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl