Prev. |  KEGG KO K16544 > 

RIKEN DNA Bank Human Resource - CEP95

Gene ID NCBI Gene 90799 |  KEGG hsa:90799
Gene Symbol CEP95
Protein Name centrosomal protein 95
Synonyms CCDC45
Ortholog resource in our bank

  CEP95

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085224 IRAL013A24 pOTB7 BC009518 NM_138363

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098419 M01C046A19 pDONR221 MGC12-E10 BC009518 NM_138363  
HGE098467 M01C046C19 pDONR221 MGC12-E10 BC009518 NM_138363  
HGE098515 M01C046E19 pDONR221 MGC12-E10 BC009518 NM_138363  
HGE098563 M01C046G19 pDONR221 MGC12-E10 BC009518 NM_138363  
HGE098611 M01C046I19 pDONR221 MGC12-E10 BC009518 NM_138363  
HGE098659 M01C046K19 pDONR221 MGC12-E10 BC009518 NM_138363  
HGE098707 M01C046M19 pDONR221 MGC12-E10 BC009518 NM_138363  
HGE098755 M01C046O19 pDONR221 MGC12-E10 BC009518 NM_138363  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR331252 RBb28C04 pGCAP1 NM_138363.1  
GGCCGGCTGATGTGGACCGTCCGACCCGCGTGTCTGATAATCCTTTGACGGGTTTTGGTC
HKR380804 RBd52A04 pGCAP10 NM_138363.1  
GAGTGTCGGGTCTGCGTGGATCGGTCCTTCCAGGACACCGTCGCCTTCCCGGCCGCGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl