Prev. | 

RIKEN DNA Bank Human Resource - PYGO2

Gene ID NCBI Gene 90780 |  KEGG hsa:90780
Gene Symbol PYGO2
Protein Name pygopus family PHD finger 2
Synonyms 1190004M21Rik
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008476 IRAK021D04 pCMV-SPORT6 BC013725 NM_138300 Partial
HGY087375 IRAL018H07 pOTB7 BC006132 NM_138300 Full
HGY091433 IRAL028J17 pOTB7 BC032099 NM_138300 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE018843 W01A047B19 pENTR-TOPO IRAL028J17 BC032099 NM_138300  
HGE018873 W01A047D01 pENTR-TOPO IRAL028J17 BC032099 NM_138300  
HGE018875 W01A047D03 pENTR-TOPO IRAL028J17 BC032099 NM_138300  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR326575 RBb16H07 pKA1U5 NM_138300.3  
GCCTTCTGGGCGATGGTGCAGCCCAAGGGCGCCTCCATCCCCCGCCGCTGCCGCTAACCC
HKR432411 RBdS081A11 pGCAP10 NM_138300.3  
gGGCgAgTCTGGAgAgAGCGCgCAgTTTGCgCgGCGGCTCGGCGCTTCCCTGTCGTCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl