Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - C19orf52

Gene ID (NCBI) 90580
Gene Symbol C19orf52
Protein Name chromosome 19 open reading frame 52
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087318 IRAL018E22 pOTB7 BC005075 NM_138358 Full
HGY088862 IRAL022C14 pOTB7 BC007244 NM_138358 Full
HGY091353 IRAL028G09 pOTB7 BC011833 NM_138358

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098831 M01C047B07 pDONR221 MGC13-C04 BC005075 NM_138358  
HGE098879 M01C047D07 pDONR221 MGC13-C04 BC005075 NM_138358  
HGE098927 M01C047F07 pDONR221 MGC13-C04 BC005075 NM_138358  
HGE098975 M01C047H07 pDONR221 MGC13-C04 BC005075 NM_138358  
HGE099023 M01C047J07 pDONR221 MGC13-C04 BC005075 NM_138358  
HGE099071 M01C047L07 pDONR221 MGC13-C04 BC005075 NM_138358  
HGE099119 M01C047N07 pDONR221 MGC13-C04 BC005075 NM_138358  
HGE099167 M01C047P07 pDONR221 MGC13-C04 BC005075 NM_138358  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR238454 ARiS096C06 pGCAP10 NM_138358.2  
GGGAAGAGGATGGCCGCGGCGGCTCTGAGGAGATTTTGGTCCCGGCGCCGCGCAGAGGCG
HKR391721 RBd79F01 pGCAP10 NM_138358.2  
GGCGACGCGGTAGTGGCGAAGCCGGGAGTGTGGGCGCGGCTGGGGTCCTGGGCCCGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl