Prev. | 

RIKEN DNA Bank Human Resource - GADD45GIP1

Gene ID NCBI Gene 90480 |  KEGG hsa:90480
Gene Symbol GADD45GIP1
Protein Name GADD45G interacting protein 1
Synonyms CKBBP2|CKbetaBP2|CRIF1|MRP-L59|PLINP|PLINP-1|PRG6|Plinp1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084479 IRAL011D07 pOTB7 BC013027 NM_052850 Partial
HGY084606 IRAL011I14 pOTB7 BC013039 NM_052850 Partial
HGY085373 IRAL013H05 pOTB7 BC004944 NM_052850 Partial
HGY101751 IRAL054G07 pOTB7 BC069200 NM_052850 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE013900 W01A034M12 pENTR-TOPO IRAL054G07 BC069200 NM_052850  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR069273 ARe73D01 pKA1U5 NM_052850.2  
GGCACAGCCAAGATGGCGGCGATCCGTGCGACAGGCANNCAGCCTACTAGGTGTGGCGGC
HKR166882 ARi17D10 pGCAP10 NM_052850.2  
AAGATGGCGGCGTCCGTGCGACAGGCACGCAGCCTACTAGGTGTGGCGGCGACCCTGGCC
HKR328050 RBb20C02 pKA1U5 NM_052850.2  
GGCACAGCCAAGATGGCGGCGTCCGTTGCGACAGGCACGCAGCCTACTAGGTGTGGCGGC
HKR333301 RBb33E05 pGCAP1 NM_052850.2  
GGCACAGCCAAGATGGCGGCGTCCGTGCGACAGGCACGCAGCCTACTAGGTGTGGCGGCG
HKR341699 RBb54E03 pGCAP1 NM_052850.2  
AAATGTGGGCACAGCCAAGATGGCGGCGTCCGTGCGACAGGCACGCAGCCTACTAGGTGT
HKR345681 RBb64D09 pGCAP1 NM_052850.2  
AAGATGGCGGCGTCCGTGCGACAGGCACGCAGCCTACTAGGTGTGGCGGCGACCCTGGCC
HKR362922 RBd07F02 pGCAP10 NM_052850.2  
AGAGTGGTGAGGACCCCGCACAGCCAAGATGGCGGCGTCCGTGCGACAGGCACGCAGCCT
HKR370884 RBd27D12 pGCAP10 NM_052850.2  
GGGCGTCCGTGCGACAGGCACGCAGCCTACTAGGTGTGGCGGCGACCCTGGCCCCGGGTT
HKR383634 RBd59B10 pGCAP10 NM_052850.2  
GGCACAGCCAAGATGGCGGCGTCCGTGCGACAGGCACGCAGCCTACTAGGTGTGGCGGCG
HKR386097 RBd65E01 pGCAP10 NM_052850.2  
GGCACAGCCAAGATGGCGGCGTCCGTGCGACAGGCACGCAGCCTACTAGGTGTGGCGGCG
HKR386835 RBd67B11 pGCAP10 NM_052850.2  
GCTGTGAGGACCCCGCACAGCCAAGATGGCGGCGTCCGTGCGACAGGCACGCAGCCTACT
HKR470848 RBdS177B24 pGCAP10 NM_052850.2  
GGTCCGTGCGACAGGCACGCAGCCTACTAGGTGTGGCGGCGACCCTGGCCCCGGGTTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl