Prev. |  KEGG KO K11791 > 

RIKEN DNA Bank Human Resource - DCAF15

Gene ID NCBI Gene 90379 |  KEGG hsa:90379
Gene Symbol DCAF15
Protein Name DDB1 and CUL4 associated factor 15
Synonyms C19orf72
Ortholog resource in our bank

  DCAF15

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086200 IRAL015I08 pOTB7 BC002926 NM_138353 Partial
HGY089728 IRAL024F08 pOTB7 BC013280 NM_138353 Partial/var
HGY101961 IRAL054P01 pOTB7 BC068994 NM_138353 Partial/var
HGY103937 IRAL059O01 pOTB7 BC080575 NM_138353

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388430 RBd71B06 pGCAP10 NM_138353.2  
TGGGGGCCGGTTGCTCCGGAAGTGGAGGGAGGGGGTGAAAATGGCGCCCAGCTCGAAATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl