Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF766

Gene ID NCBI Gene 90321 |  KEGG hsa:90321
Gene Symbol ZNF766
Protein Name zinc finger protein 766
Synonyms -
Ortholog resource in our bank

  ZNF766

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR169630 ARi24B06 pGCAP10 NM_001010851.2  
GGGCGTGGAGATATGGCGCAACTGCGGCGCGATTGACTTCTAAAGANNCATGTTGGCCGG
HKR172474 ARi31D02 pGCAP10 NM_001010851.2  
GAGACCCGGAAGTGGATGGCGTGGAGATATGGCGCAACTGCGGCGCGGACACTTGACATT
HKR175236 ARi38B12 pGCAP10 NM_001010851.2  
GGGAAGCAGATTACGTGGAGTGACGGTCATGCTGCGGCGTGGACACTTGGCATTCAGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl