Prev. | 

RIKEN DNA Bank Human Resource - TP53I13

Gene ID NCBI Gene 90313 |  KEGG hsa:90313
Gene Symbol TP53I13
Protein Name tumor protein p53 inducible protein 13
Synonyms DSCP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081375 IRAL003H07 pOTB7 BC001593 NM_138349
HGY085864 IRAL014K24 pOTB7 BC004507 NM_138349 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE082006 M01C005A06 pDONR221 04-134-2_3-B03 AK075341 NM_138349  
HGE082054 M01C005C06 pDONR221 04-134-2_3-B03 AK075341 NM_138349  
HGE082102 M01C005E06 pDONR221 04-134-2_3-B03 AK075341 NM_138349  
HGE082150 M01C005G06 pDONR221 04-134-2_3-B03 AK075341 NM_138349  
HGE082198 M01C005I06 pDONR221 04-134-2_3-B03 AK075341 NM_138349  
HGE082246 M01C005K06 pDONR221 04-134-2_3-B03 AK075341 NM_138349  
HGE082294 M01C005M06 pDONR221 04-134-2_3-B03 AK075341 NM_138349  
HGE082342 M01C005O06 pDONR221 04-134-2_3-B03 AK075341 NM_138349  
HGE085610 M01C014A10 pDONR221 FLJ04-F05 AK075341 NM_138349  
HGE085658 M01C014C10 pDONR221 FLJ04-F05 AK075341 NM_138349  
HGE085706 M01C014E10 pDONR221 FLJ04-F05 AK075341 NM_138349  
HGE085754 M01C014G10 pDONR221 FLJ04-F05 AK075341 NM_138349  
HGE085802 M01C014I10 pDONR221 FLJ04-F05 AK075341 NM_138349  
HGE085850 M01C014K10 pDONR221 FLJ04-F05 AK075341 NM_138349  
HGE085898 M01C014M10 pDONR221 FLJ04-F05 AK075341 NM_138349  
HGE085946 M01C014O10 pDONR221 FLJ04-F05 AK075341 NM_138349  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR364805 RBd12A05 pGCAP10 NM_138349.2  
GGGGCCGGGCCCGGGGCCGCTTGGAATGGCGCCTCCTCCGCCTTCGCCCCAACTGCTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl