Prev. |  KEGG KO K18343 > 

RIKEN DNA Bank Human Resource - OTULIN

Gene ID NCBI Gene 90268 |  KEGG hsa:90268
Gene Symbol OTULIN
Protein Name OTU deubiquitinase with linear linkage specificity
Synonyms AIPDS|FAM105B|GUM
Ortholog resources KEGG ortholog (KEGG orthology K18343) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011125 IRAK027N13 pCMV-SPORT6 BC015392 NM_138348 Full
HGY086335 IRAL015N23 pOTB7 BC007706 NM_138348 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098440 M01C046B16 pDONR221 MGC12-H08 BC007706 NM_138348  
HGE098488 M01C046D16 pDONR221 MGC12-H08 BC007706 NM_138348  
HGE098536 M01C046F16 pDONR221 MGC12-H08 BC007706 NM_138348  
HGE098584 M01C046H16 pDONR221 MGC12-H08 BC007706 NM_138348  
HGE098632 M01C046J16 pDONR221 MGC12-H08 BC007706 NM_138348  
HGE098680 M01C046L16 pDONR221 MGC12-H08 BC007706 NM_138348  
HGE098728 M01C046N16 pDONR221 MGC12-H08 BC007706 NM_138348  
HGE098776 M01C046P16 pDONR221 MGC12-H08 BC007706 NM_138348  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR012073 ARa30D01 pKA1U5 NM_138348.4  
TGACCCCTCGGCAAACCGCCCCGTGCGGCTGAGAGGCTGCGGNCACTGCCTGGCACCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl