Prev. | 

RIKEN DNA Bank Human Resource - TMEM250

Gene ID NCBI Gene 90120 |  KEGG hsa:90120
Gene Symbol TMEM250
Protein Name transmembrane protein 250
Synonyms C9orf69
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056250 IRAK140K10 pCMV-SPORT6 BC064970 XM_946029 Full
HGY090160 IRAL025G16 pOTB7 BC014304 XM_946029 Full
HGY090236 IRAL025J20 pOTB7 BC013282 XM_946029 Full
HGY090246 IRAL025K06 pOTB7 BC009229 XM_946029 Partial/var
HGY090423 IRAL026A23 pOTB7 BC021231 XM_946029 Full
HGY103734 IRAL059F14 pOTB7 BC084549 XM_946029 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076060 ARe90C12 pKA1U5 NM_152833.2  
GGACGGCGCCTACGGCTCCCACGCCTAGGCCAAACGCCTCCGGCGGCCGCGCCCGAGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl