Prev. |  KEGG KO K20803 > 

RIKEN DNA Bank Human Resource - UBE3D

Gene ID NCBI Gene 90025 |  KEGG hsa:90025
Gene Symbol UBE3D
Protein Name ubiquitin protein ligase E3D
Synonyms C6orf157|H10BH|UBE2CBP|YJR141W
Ortholog resources KEGG ortholog (KEGG orthology K20803) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046079 IRAK115D07 pCMV-SPORT6 BC053645 NM_198920 Full
HGY053562 IRAK133P02 pBluescript BC057845 NM_198920 Full/var
HGY102802 IRAL057A02 pDNR-LIB BC071763 NM_198920 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR332130 RBb30F10 pGCAP1 NM_198920.1  
GGCCGCAGCGGGGCTGCCGCTGGTTGGTCCGCACGTGGAACCTCTCCTGGTCCTGTTGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl