Prev. | 

RIKEN DNA Bank Human Resource - SAPCD2

Gene ID NCBI Gene 89958 |  KEGG hsa:89958
Gene Symbol SAPCD2
Protein Name suppressor APC domain containing 2
Synonyms C9orf140|p42.3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010672 IRAK026L08 pCMV-SPORT6 BC048267 NM_178448
HGX037247 IRAK093B23 pCMV-SPORT6 BC048267 NM_178448
HGY089239 IRAL023B15 pOTB7 BC009435 NM_178448 Partial
HGY097728 IRAL044F08 pOTB7 BC042162 NM_178448 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180128 ARi50F08 pGCAP10 NM_178448.3  
GGCTATTGTCGCCGTGGGCTGAGCTCGCCGGGCCGGCCCCTCCGTGGGGCCGCGCTGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl