Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANKRD13A

Gene ID (NCBI) 88455
Gene Symbol ANKRD13A
Protein Name ankyrin repeat domain 13A
Synonyms ANKRD13|NY-REN-25
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY013776 IRAK034H08 pBluescriptR BC032833 NM_033121 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE099617 M01C049A17 pDONR221 MGC14-A09 BC032833 ENST00000334689  
HGE099665 M01C049C17 pDONR221 MGC14-A09 BC032833 ENST00000334689  
HGE099713 M01C049E17 pDONR221 MGC14-A09 BC032833 ENST00000334689  
HGE099761 M01C049G17 pDONR221 MGC14-A09 BC032833 ENST00000334689  
HGE099809 M01C049I17 pDONR221 MGC14-A09 BC032833 ENST00000334689  
HGE099857 M01C049K17 pDONR221 MGC14-A09 BC032833 ENST00000334689  
HGE099905 M01C049M17 pDONR221 MGC14-A09 BC032833 ENST00000334689  
HGE099953 M01C049O17 pDONR221 MGC14-A09 BC032833 ENST00000334689  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065231 ARe63B07 pKA1U5 NM_033121.1  
GGAAAGAAGCTGGGGACAGGTAGACGGAACTTTCCGCGTGGAGATCTTTGGCCAAGAGAA
HKR264407 ARiS161A07 pGCAP10 NM_033121.1  
GGTCTGTCCGCGAGCTGTCAGCGCGGGCGGGAACGCCGCGGGGCGCGGGGTGGGCGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl