Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SSH2

Gene ID (NCBI) 85464
Gene Symbol SSH2
Protein Name slingshot protein phosphatase 2
Synonyms SSH-2|SSH-2L
Databases KEGG hsa:85464 |  NCBI Gene 85464
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05766)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY101601 IRAL054A01 pOTB7 BC068223 NM_033389

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR208040 ARiS020B16 pGCAP10 NM_033389.2  
CGGCCGGCCGATGAGTCGGCGACAGTCTGGTGGTGGGTGCGGAGTCTGCGGCCGTTCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.22

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl