Prev. | 

RIKEN DNA Bank Human Resource - DIXDC1

Gene ID NCBI Gene 85458 |  KEGG hsa:85458
Gene Symbol DIXDC1
Protein Name DIX domain containing 1
Synonyms CCD1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04797 SEREX clone NGO-Pr-182 (ID 2537) #1 SEREX clone NGO-Pr-182 (ID 2537) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018585 IRAK046H17 pBluescriptR BC033034 NM_033425 Full
HGX037471 IRAK093L07 pCMV-SPORT6 BC048294 NM_001037954 Partial/var
HGY097679 IRAL044D07 pOTB7 BC041626 NM_033425 Partial
HGY095819 IRAL039J03 pOTB7 BC035509 NM_001037954 Partial/var
HGY100147 IRAL050G03 pOTB7 BC064479 NM_001037954 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE027939 W01A069O03 pENTR-TOPO IRAK046H17 BC033034 NM_033425  
HGE027945 W01A069O09 pENTR-TOPO IRAK046H17 BC033034 NM_033425  
HGE027947 W01A069O11 pENTR-TOPO IRAK046H17 BC033034 NM_033425  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR384951 RBd62G07 pGCAP10 NM_001037954.2  
GGCCTGGCCGTGCGGCTTTCCCGCAGGAAAGCGGGGCTGGGGGCAGCCCGGCAGCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl