Prev. | 

RIKEN DNA Bank Human Resource - TNKS1BP1

Gene ID NCBI Gene 85456 |  KEGG hsa:85456
Gene Symbol TNKS1BP1
Protein Name tankyrase 1 binding protein 1
Synonyms TAB182
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX043144 IRAK107O08 pCMV-SPORT6 BC046216 NM_033396 Partial/var
HGY093424 IRAL033J08 pOTB7 BC023622 NM_033396 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045731 ARe14F11 pKA1U5 NM_033396.2  
GGGCGGCGGCGGCGGCGGTAGCAGCGGCGGCGGCGGCGGGGACTGGCATCGGGGCCCCGA
HKR181749 ARi54G05 pGCAP10 NM_033396.2  
GGGGGCTCGCAGTGGCTTCGTCCCGCGGTGACGGCGGCGGCGGCGGCGGTAGCAGCGGCG
HKR222290 ARiS055M02 pGCAP10 NM_033396.2  
GACAGACAGACTTCATACTTTGCAGCTCTCTAGCTCTGCTTTGAGTAGACACCTCCAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl