Prev. |  KEGG KO K13154 > 

RIKEN DNA Bank Human Resource - ZCRB1

Gene ID NCBI Gene 85437 |  KEGG hsa:85437
Gene Symbol ZCRB1
Protein Name zinc finger CCHC-type and RNA binding motif containing 1
Synonyms MADP-1|MADP1|RBM36|SNRNP31|ZCCHC19
Ortholog resource in our bank

  ZCRB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY012945 IRAK032G01 pBluescriptR BC022543 NM_033114 Full/var
HGY091252 IRAL028C04 pOTB7 BC010177 NM_033114 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089201 M01C023A01 pDONR221 MGC01-A01 BC022543 NM_033114  
HGE089249 M01C023C01 pDONR221 MGC01-A01 BC022543 NM_033114  
HGE089297 M01C023E01 pDONR221 MGC01-A01 BC022543 NM_033114  
HGE089345 M01C023G01 pDONR221 MGC01-A01 BC022543 NM_033114  
HGE089393 M01C023I01 pDONR221 MGC01-A01 BC022543 NM_033114  
HGE089441 M01C023K01 pDONR221 MGC01-A01 BC022543 NM_033114  
HGE089489 M01C023M01 pDONR221 MGC01-A01 BC022543 NM_033114  
HGE089537 M01C023O01 pDONR221 MGC01-A01 BC022543 NM_033114  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR338025 RBb45B01 pGCAP1 NM_033114.3  
GCTTCGGGGCCCGGATCTCAAACAGTCGGGAAGAAGCACCGTGGCTGCTATTATCTGCTC
HKR367773 RBd19H05 pGCAP10 NM_033114.3  
GAAACAGCCGGGAAGAAGCACCGTGGCTGCTATTATCTGCTCTCCGCGCCTGACCCCTCC
HKR406239 RBdS015J23 pGCAP10 NM_033114.3  
GAGTCGGGAAGAAGCACCGTGGCTGCTATTATCTGCTCTCCGCGCCTGACCCCTCCCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl