Prev. |  KEGG KO K09226 > 

RIKEN DNA Bank Human Resource - ZIC5

Gene ID NCBI Gene 85416 |  KEGG hsa:85416
Gene Symbol ZIC5
Protein Name Zic family member 5
Synonyms -
Ortholog resource in our bank

  ZIC5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR384126 RBd60F06 pGCAP10 NM_033132.3  
GGCCTTCATCTGGGGAAATTCGTGGCCACTGCAAGTTTACTACGCGAGGCGCAGCCAATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl