Prev. |  KEGG KO K20655 > 

RIKEN DNA Bank Human Resource - SYDE1

Gene ID NCBI Gene 85360 |  KEGG hsa:85360
Gene Symbol SYDE1
Protein Name synapse defective Rho GTPase homolog 1
Synonyms 7h3|SYD1
Ortholog resource in our bank

  SYDE1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020927 IRAK052F07 pCMV-SPORT6 BC029926 NM_033025 Full/var
HGY088232 IRAL020J16 pOTB7 BC018942 NM_033025 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058079 ARe45D07 pKA1U5 NM_033025.4  
GGCGCACTCGGCTCGGCCCGGCCCGGGCCGCAGCATGGCCGAGCCGCTACTCAGGAAAAC
HKR061729 ARe54F09 pKA1U5 NM_033025.4  
GGCGGAGAAGGTAAACCAGCGCCCCGAGTTGAGGCGCGGGTTTGGTGGCGCGTTTCAGCG
HKR073606 ARe84A06 pKA1U5 NM_033025.4  
GGGGCGGCGCGGCCGGAGCCCGGGGCGCGCACTCGGCTCGGCCCGGCCCGGGCCGCAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl