Prev. |  KEGG KO K12735 > 

RIKEN DNA Bank Human Resource - PPIL4

Gene ID NCBI Gene 85313 |  KEGG hsa:85313
Gene Symbol PPIL4
Protein Name peptidylprolyl isomerase like 4
Synonyms HDCME13P
Ortholog resource in our bank

  PPIL4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008318 IRAK020N06 pCMV-SPORT6 BC020986 NM_139126 Full
HGX056655 IRAK141K15 pCMV-SPORT6 BC064134 NM_139126 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR392172 RBd80H04 pGCAP10 NM_139126.2  
GGGAGGAGGAGCGGGCGCCATGGCGGTTCTACTGGAGACCACTTTAGGCGACGTCGTCAT
HKR406136 RBdS015F16 pGCAP10 NM_139126.2  
GGGAGGAGGAGCGGGCGCCATGGCGGTTCTACTGGAGACCACTTTAGGCGACGTCGTCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl