Prev. |  KEGG KO K11252 > 

RIKEN DNA Bank Human Resource - H2BC12

Gene ID NCBI Gene 85236 |  KEGG hsa:85236
Gene Symbol H2BC12
Protein Name H2B clustered histone 12
Synonyms H2B/S|H2BFAiii|H2BFT|H2BK|HIST1H2BK
Ortholog resource in our bank

  H2BC12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13362 pYNL-C1_H2B Yellow Nano-lantern for labeling of nuclei in interphase by the human histone H2B.
RDB13363 pCNL-C1_H2B Cyan Nano-lantern for labeling of nuclei in interphase by the human histone H2B.
RDB13364 pONL-C1_H2B Orange Nano-lantern for labeling of nuclei in interphase by the human histone H2B.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001742 IRAK004F22 pCMV-SPORT6 BC000893 -
HGX044372 IRAK110P12 pCMV-SPORT6 BC051872 -
HGX056166 IRAK140G22 pCMV-SPORT6 BC064959 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE010195 W01A025I03 pENTR-TOPO IRAK004F22 BC000893 -  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178545 ARi46G01 pGCAP10 NM_080593.1  
CGGCCGGCCGATATCGTGTGTGGCATTACTTCCCGTTTTCTCGATCTGCTGCTCGTCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl