Prev. | 

RIKEN DNA Bank Human Resource - SMIM3

Gene ID NCBI Gene 85027 |  KEGG hsa:85027
Gene Symbol SMIM3
Protein Name small integral membrane protein 3
Synonyms C5orf62|MST150|NID67
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE117623 M01C094A23 pDONR221 IMS10-E12 AK125286 NM_032947  
HGE117671 M01C094C23 pDONR221 IMS10-E12 AK125286 NM_032947  
HGE117719 M01C094E23 pDONR221 IMS10-E12 AK125286 NM_032947  
HGE117767 M01C094G23 pDONR221 IMS10-E12 AK125286 NM_032947  
HGE117815 M01C094I23 pDONR221 IMS10-E12 AK125286 NM_032947  
HGE117863 M01C094K23 pDONR221 IMS10-E12 AK125286 NM_032947  
HGE117911 M01C094M23 pDONR221 IMS10-E12 AK125286 NM_032947  
HGE117959 M01C094O23 pDONR221 IMS10-E12 AK125286 NM_032947  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040458 ARe01C10 pKA1U5 NM_032947.4  
TGCCCGCCTCCCGGGGCTCGGAGGAGCCGGGGCACGTTCCAGGAGCTGCCTAGGGCTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl