Prev. | 

RIKEN DNA Bank Human Resource - TMEM60

Gene ID NCBI Gene 85025 |  KEGG hsa:85025
Gene Symbol TMEM60
Protein Name transmembrane protein 60
Synonyms C7orf35|DC32
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056232 IRAK140J16 pCMV-SPORT6 BC065930 NM_032936 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096043 M01C040B19 pDONR221 MGC09-G10 BC065930 NM_032936  
HGE096091 M01C040D19 pDONR221 MGC09-G10 BC065930 NM_032936  
HGE096139 M01C040F19 pDONR221 MGC09-G10 BC065930 NM_032936  
HGE096187 M01C040H19 pDONR221 MGC09-G10 BC065930 NM_032936  
HGE096235 M01C040J19 pDONR221 MGC09-G10 BC065930 NM_032936  
HGE096283 M01C040L19 pDONR221 MGC09-G10 BC065930 NM_032936  
HGE096331 M01C040N19 pDONR221 MGC09-G10 BC065930 NM_032936  
HGE096379 M01C040P19 pDONR221 MGC09-G10 BC065930 NM_032936  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068552 ARe71G08 pKA1U5 NM_032936.3  
GAGCCCCGGATGTGGGCGCGGCACTGAGGTAGAACTGAGAGATCCTCTACCGCAGTCGTT
HKR345234 RBb63B10 pGCAP1 NM_032936.3  
AGAACTGAGAGATCCTCTACCGCAGTCGTTTGAGGAGGCGGAACTGAAGTTTTTTCTTAA
HKR471047 RBdS177K07 pGCAP10 NM_032936.3  
GGAGATCCTCTACCGCAGTCGTTTGAGGAGGCGGAACTGAAGTTTTTTCTTAATTATCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl