Prev. | 

RIKEN DNA Bank Human Resource - TMEM141

Gene ID NCBI Gene 85014 |  KEGG hsa:85014
Gene Symbol TMEM141
Protein Name transmembrane protein 141
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088056 IRAL020C08 pOTB7 BC007834 NM_032928

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098845 M01C047B21 pDONR221 MGC13-C11 BC007834 NM_032928  
HGE098893 M01C047D21 pDONR221 MGC13-C11 BC007834 NM_032928  
HGE098941 M01C047F21 pDONR221 MGC13-C11 BC007834 NM_032928  
HGE098989 M01C047H21 pDONR221 MGC13-C11 BC007834 NM_032928  
HGE099037 M01C047J21 pDONR221 MGC13-C11 BC007834 NM_032928  
HGE099085 M01C047L21 pDONR221 MGC13-C11 BC007834 NM_032928  
HGE099133 M01C047N21 pDONR221 MGC13-C11 BC007834 NM_032928  
HGE099181 M01C047P21 pDONR221 MGC13-C11 BC007834 NM_032928  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR408822 RBdS022A22 pGCAP10 NM_032928.3  
GGCCCTTCCGCCTGCGCCTGCGCAGGCCCGCTCCCCGAGCCCTGCCAACCATGGTGAACT
HKR428034 RBdS070B10 pGCAP10 NM_032928.3  
GGCCTGCGCAGGCCCGCTCCCCGAGCCCTGCCAACCATGGTGAACTTGGGTCTGTCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl