Prev. | 

RIKEN DNA Bank Human Resource - TMEM128

Gene ID NCBI Gene 85013 |  KEGG hsa:85013
Gene Symbol TMEM128
Protein Name transmembrane protein 128
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087152 IRAL017O16 pOTB7 BC007729 NM_032927

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098811 M01C047A11 pDONR221 MGC13-A06 BC007729 NM_032927  
HGE098859 M01C047C11 pDONR221 MGC13-A06 BC007729 NM_032927  
HGE098907 M01C047E11 pDONR221 MGC13-A06 BC007729 NM_032927  
HGE098955 M01C047G11 pDONR221 MGC13-A06 BC007729 NM_032927  
HGE099003 M01C047I11 pDONR221 MGC13-A06 BC007729 NM_032927  
HGE099051 M01C047K11 pDONR221 MGC13-A06 BC007729 NM_032927  
HGE099099 M01C047M11 pDONR221 MGC13-A06 BC007729 NM_032927  
HGE099147 M01C047O11 pDONR221 MGC13-A06 BC007729 NM_032927  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175233 ARi38B09 pGCAP10 NM_032927.2  
TTTTCGGGGCGGTACCAAGATGGACTCCTCGCGGGCCCGACAGCAGCTCCGGCGGCGATT
HKR378055 RBd45C07 pGCAP10 NM_032927.2  
GATTTTCGGGGCGGTACCAAGATGGACTCCTCGCGGGCCCGGCAGCAGCTCCGGCGGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl