Prev. | 

RIKEN DNA Bank Human Resource - UBL7

Gene ID NCBI Gene 84993 |  KEGG hsa:84993
Gene Symbol UBL7
Protein Name ubiquitin like 7
Synonyms BMSC-UbP|TCBA1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088315 IRAL020N03 pOTB7 BC007913 NM_201265 Full
HGY093893 IRAL034M05 pOTB7 BC030055 NM_201265 Full
HGY093951 IRAL034O15 pOTB7 BC033919 NM_201265 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE113628 M01C084B04 pDONR221 IMS05-H02 BC007913 NM_201265  
HGE113676 M01C084D04 pDONR221 IMS05-H02 BC007913 NM_201265  
HGE113724 M01C084F04 pDONR221 IMS05-H02 BC007913 NM_201265  
HGE113772 M01C084H04 pDONR221 IMS05-H02 BC007913 NM_201265  
HGE113820 M01C084J04 pDONR221 IMS05-H02 BC007913 NM_201265  
HGE113868 M01C084L04 pDONR221 IMS05-H02 BC007913 NM_201265  
HGE113916 M01C084N04 pDONR221 IMS05-H02 BC007913 NM_201265  
HGE113964 M01C084P04 pDONR221 IMS05-H02 BC007913 NM_201265  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR378030 RBd45B06 pGCAP10 NM_032907.3  
GGGAATTTCCGGTTTCCGGCGAGAGGGCCAGAGGAGAAAGAGAGAGCGCGAAAGAGAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl