Prev. |  KEGG KO K11001 > 

RIKEN DNA Bank Human Resource - PIGY

Gene ID NCBI Gene 84992 |  KEGG hsa:84992
Gene Symbol PIGY
Protein Name phosphatidylinositol glycan anchor biosynthesis class Y
Synonyms HPMRS6|PIG-Y
Ortholog resources KEGG ortholog (KEGG orthology K11001) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088029 IRAL020B05 pOTB7 BC007876 NM_032906 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046007 ARe15A07 pKA1U5 NM_032906.3  
GGGCCACGGGTGGCGAGGCTGCGGTGAGGCCTGGTCTCCGGCTGCCAGACCATGCTGAGT
HKR066456 ARe66C08 pKA1U5 NM_032906.3  
GGGGCGGGGCCTGCCCGGCTGGCCTGGACGAACGGGAAGCCGGGAGCTCGGCCACGGGTG
HKR175657 ARi39C09 pGCAP10 NM_032906.3  
GGGCCACGGGTGGCGAGGCTGCGGTGAGGCCTGGTCTCCGGCTGCCAGACCATGCTGAGT
HKR176481 ARi41D09 pGCAP10 NM_032906.3  
GAGCCGGGAGCTCGGCCACGGGTGGCGAGGCTGCGGTGAGGCCTGGTCTCCGGCTGCCAG
HKR179749 ARi49G05 pGCAP10 NM_032906.3  
GGGGTGGCGAGGCTGCGGTGAGGCCTGGTCTCCGGCTGCCAGACCATGCTGAGTGGAGCA
HKR218032 ARiS045B08 pGCAP10 NM_032906.3  
GGCCCGGCTGGCCTGGACGAACGGGAAGCCGGGAGCTCGGCCACGGGTGGCGAGGCTGCG
HKR348102 RBb70E06 pGCAP1 NM_032906.3  
TGGGGAGCTCGGCCACGGGTGGCGAGGCTGCGGTGAGGCCTGGTCTCCGGCTGCCAGACC
HKR362403 RBd06A03 pGCAP10 NM_032906.3  
GGGAGTGGAGGACGCTGCAGGCTCGCCTCAACGCTGCGGGGAACGCGCGCGCCGCCGTCC
HKR380931 RBd52F11 pGCAP10 NM_032906.3  
GACGGGTGGCGAGGCTGCGGTGAGGCCTGGTCTCCGGCTGCCAGACCATGCTGAGTGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl