Prev. |  KEGG KO K12840 > 

RIKEN DNA Bank Human Resource - RBM17

Gene ID NCBI Gene 84991 |  KEGG hsa:84991
Gene Symbol RBM17
Protein Name RNA binding motif protein 17
Synonyms SPF45
Ortholog resources KEGG ortholog (KEGG orthology K12840) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005389 IRAK013H21 pCMV-SPORT6 BC009064 NM_032905 Partial/var
HGY029617 IRAK074A17 pBluescriptR BC039322 NM_032905 Full
HGY088352 IRAL020O16 pOTB7 BC007871 NM_032905 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006539 W01A016F19 pENTR-TOPO IRAL020O16 BC007871 NM_032905  
HGE006541 W01A016F21 pENTR-TOPO IRAL020O16 BC007871 NM_032905  
HGE006543 W01A016F23 pENTR-TOPO IRAL020O16 BC007871 NM_032905  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052145 ARe30G01 pKA1U5 NM_032905.3  
ATCCTGGAGCCCGCGCTCCCTGACCCCGCGCCGCCGAGCGCCCTGAGGACTCAGCGAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl