Prev. | 

RIKEN DNA Bank Human Resource - MFSD5

Gene ID NCBI Gene 84975 |  KEGG hsa:84975
Gene Symbol MFSD5
Protein Name major facilitator superfamily domain containing 5
Synonyms hsMOT2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067325 IRAK168F05 pBluescriptR BC067795 NM_032889 Full/var
HGY086037 IRAL015B13 pOTB7 BC007703 NM_032889 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE084413 M01C011A13 pDONR221 FLJ03-A07 AK074684 ENST00000329548  
HGE084461 M01C011C13 pDONR221 FLJ03-A07 AK074684 ENST00000329548  
HGE084509 M01C011E13 pDONR221 FLJ03-A07 AK074684 ENST00000329548  
HGE084557 M01C011G13 pDONR221 FLJ03-A07 AK074684 ENST00000329548  
HGE084605 M01C011I13 pDONR221 FLJ03-A07 AK074684 ENST00000329548  
HGE084653 M01C011K13 pDONR221 FLJ03-A07 AK074684 ENST00000329548  
HGE084701 M01C011M13 pDONR221 FLJ03-A07 AK074684 ENST00000329548  
HGE084749 M01C011O13 pDONR221 FLJ03-A07 AK074684 ENST00000329548  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR191636 ARi79B12 pGCAP10 NM_032889.3  
GACGTGACGAAGCCATCATGGCGGCGGCCAGAGGCCTGCCCGGCTCCCGGAAGCAGGCTG
HKR323251 RBb08C03 pKA1U5 NM_032889.3  
AGCGCTGCTGGAACCCGAGCCGGAGCCGGAGCCACAGCGGGGAGGGTGGCCTGGCGGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl