Prev. | 

RIKEN DNA Bank Human Resource - SNHG7

Gene ID NCBI Gene 84973 |  KEGG hsa:84973
Gene Symbol SNHG7
Protein Name small nucleolar RNA host gene 7
Synonyms NCRNA00061
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY028515 IRAK071E19 pBluescriptR BC042667
HGY042437 IRAK106B13 pBluescript BC042369
HGX046060 IRAK115C12 pCMV-SPORT6 BC055011
HGX053941 IRAK134O05 pCMV-SPORT6 BC059956

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE082813 M01C007A13 pDONR221 FLJ01-A07 AK090585  
HGE082861 M01C007C13 pDONR221 FLJ01-A07 AK090585  
HGE082909 M01C007E13 pDONR221 FLJ01-A07 AK090585  
HGE082957 M01C007G13 pDONR221 FLJ01-A07 AK090585  
HGE083005 M01C007I13 pDONR221 FLJ01-A07 AK090585  
HGE083053 M01C007K13 pDONR221 FLJ01-A07 AK090585  
HGE083101 M01C007M13 pDONR221 FLJ01-A07 AK090585  
HGE083149 M01C007O13 pDONR221 FLJ01-A07 AK090585  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235391 ARiS088H23 pGCAP10 NR_003672.2  
GCTCTGCGTGCGCCGGAGGCTGCCGTGGCGGGTGGGCCGCCTGACTTCTCCTCCCGGCCA
HKR330176 RBb25H08 pGCAP1 NR_003672.2  
GCTCTGCGTGCGCCGGAGGCTGCCGTGGCGGGTGGGCCCCCTTGTACTTCTCCTCCCGGC
HKR368125 RBd20F05 pGCAP10 NR_003672.2  
GGCTCTGCGTGCGCCGGAGGCTGCCGTGGCGGGTGGGCCGCCTGACTTCTCCTCCCGGCC
HKR383607 RBd59A07 pGCAP10 NR_003672.2  
GCTCTGCGTGCGCCGGAGGCTGCCGTGGCGGGTGGGCCGCCTGACTTCTCCTCCCGGCCA
HKR386098 RBd65E02 pGCAP10 NR_003672.2  
GCTCTGCGTGCGCCGGAGGCTGCCGTGGCGGGTGGGCCGCCTGACTTCTCCTCCCGGCCA
HKR392480 RBd81D08 pGCAP10 NR_003672.2  
GCTCTGCGTGCGCCGGAGGCTGCCGTGGCGGGTGGGCCCCCTGACTTCTCCTCCCGGCCA
HKR403147 RBdS007O11 pGCAP10 NR_003672.2  
GCTCTGCGTGCGCCGGAGGCTGCCGTGGCGGGTGGGCCGCCTGACTTCTCCTCCCGGCCA
HKR416328 RBdS040N16 pGCAP10 NR_003672.2  
GCTCTGCGTGCGCCGGAGGCTGCCGTGGCGGGTGGGCCGCCTGACTTCTCCTCCCGGCCA
HKR420566 RBdS051G22 pGCAP10 NR_003672.2  
GCTCTGCGTGCGCCGGAGGCTGCCGTGGCGGGTGGGCCCCCTGACTTCTCCTCCCGGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl