Prev. | 

RIKEN DNA Bank Human Resource - LSM10

Gene ID NCBI Gene 84967 |  KEGG hsa:84967
Gene Symbol LSM10
Protein Name LSM10, U7 small nuclear RNA associated
Synonyms MST074|MSTP074
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089211 IRAL023A11 pOTB7 BC007623 NM_032881

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE035962 W01A089P02 pENTR-TOPO IRAL023A11 BC007623 NM_032881  
HGE035970 W01A089P10 pENTR-TOPO IRAL023A11 BC007623 NM_032881  
HGE035974 W01A089P14 pENTR-TOPO IRAL023A11 BC007623 NM_032881  
HGE035978 W01A089P18 pENTR-TOPO IRAL023A11 BC007623 NM_032881  
HGE035980 W01A089P20 pENTR-TOPO IRAL023A11 BC007623 NM_032881  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070849 ARe77C01 pKA1U5 NM_032881.1  
GACTGACGCACTTCTGCGCCCGGAGGTACAGAGCGCCNTTNGATCGCCGGCATGGTTTCT
HKR380970 RBd52H02 pGCAP10 NM_032881.1  
GGCAGAGCACTGACGCACTCTGCGCCCGGAGGACAGAGCGGCCCGGTCGCCGGCATGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl