Prev. |  KEGG KO K16682 > 

RIKEN DNA Bank Human Resource - AJUBA

Gene ID NCBI Gene 84962 |  KEGG hsa:84962
Gene Symbol AJUBA
Protein Name ajuba LIM protein
Synonyms JUB
Featured content Hippo signaling (human)
Ortholog resource in our bank

  AJUBA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013871 IRAK034L07 pBluescriptR BC034968 NM_198086 Full
HGY088984 IRAL022H16 pOTB7 BC007580 NM_198086 Full
HGY092950 IRAL032G06 pDNR-LIB BC016733 NM_198086

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067660 ARe69C12 pKA1U5 NM_032876.4  
AGATAGACCTGCGGACTGGACAGCTGCGGCCAGAGACCCTGCTAGCCCCGCTCAGCCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl