Prev. |  KEGG KO K18993 > 

RIKEN DNA Bank Human Resource - UBASH3B

Gene ID NCBI Gene 84959 |  KEGG hsa:84959
Gene Symbol UBASH3B
Protein Name ubiquitin associated and SH3 domain containing B
Synonyms STS-1|STS1|TULA-2|TULA2|p70
Ortholog resource in our bank

  UBASH3B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088848 IRAL022B24 pOTB7 BC007541 NM_032873 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE082001 M01C005A01 pDONR221 04-134-2_3-A01 AK075203 NM_032873  
HGE082049 M01C005C01 pDONR221 04-134-2_3-A01 AK075203 NM_032873  
HGE082097 M01C005E01 pDONR221 04-134-2_3-A01 AK075203 NM_032873  
HGE082145 M01C005G01 pDONR221 04-134-2_3-A01 AK075203 NM_032873  
HGE082193 M01C005I01 pDONR221 04-134-2_3-A01 AK075203 NM_032873  
HGE082241 M01C005K01 pDONR221 04-134-2_3-A01 AK075203 NM_032873  
HGE082289 M01C005M01 pDONR221 04-134-2_3-A01 AK075203 NM_032873  
HGE082337 M01C005O01 pDONR221 04-134-2_3-A01 AK075203 NM_032873  
HGE110829 M01C077B05 pDONR221 06-2_02-C03 AK075203 NM_032873  
HGE085223 M01C013A23 pDONR221 FLJ04-A12 AK075203 NM_032873  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075326 ARe88F06 pKA1U5 NM_032873.4  
GATCCGGCTCGGGCTCCTTCCCTGGCGATGGCTGGCCGCTGAGCCATGGCTCAGTACGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl