Prev. |  KEGG KO K17598 > 

RIKEN DNA Bank Human Resource - SYTL1

Gene ID NCBI Gene 84958 |  KEGG hsa:84958
Gene Symbol SYTL1
Protein Name synaptotagmin like 1
Synonyms JFC1|SLP1
Ortholog resource in our bank

  SYTL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031752 IRAK079G08 pCMV-SPORT6 BC035725 NM_032872 Full/var
HGY090126 IRAL025F06 pOTB7 BC009224 NM_032872 Partial/var
HGY093633 IRAL034B09 pOTB7 BC015764 NM_032872 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR336001 RBb40A01 pGCAP1 NM_032872.1  
TTTTTGAGCTGCTGGCTGGGCTGCCTGTTGAGTCAGCCTTCTTCCCTCACGGCTCTTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl