Prev. | 

RIKEN DNA Bank Human Resource - PWWP3A

Gene ID NCBI Gene 84939 |  KEGG hsa:84939
Gene Symbol PWWP3A
Protein Name PWWP domain containing 3A, DNA repair factor
Synonyms EXPAND1|HSPC211|MUM-1|MUM1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069908 IRAK174M20 pCMV-SPORT6 BC082987 NM_032853 Partial
HGY082725 IRAL006N13 pOTB7 BC001806 NM_001369790.1 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR330079 RBb25D07 pGCAP1 NM_032853.2  
GGCCCCCGGCCCCGCGGGGAGCGGCGGCGGCGGCGGCGGCGGTGGCGGAGGCGGACACAT
HKR405900 RBdS014M12 pGCAP10 NM_032853.2  
AAAGGCGGGGAGCGGCGGCGGCGGCGGCGGCGGTGGCGGAGGCGGACACATTGGCGTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl