Prev. | 

RIKEN DNA Bank Human Resource - ZFYVE19

Gene ID NCBI Gene 84936 |  KEGG hsa:84936
Gene Symbol ZFYVE19
Protein Name zinc finger FYVE-type containing 19
Synonyms ANCHR|MPFYVE
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093910 IRAL034M22 pOTB7 BC015738 NM_032850 Full/var
HGY096178 IRAL040H10 pOTB7 BC021092 NM_032850 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208085 ARiS020D13 pGCAP10 NM_001077268.1  
GAGTGGGCGTGTGGGGCGGGGCGGGGCAGGGCAGGGAAGGGAAGGGCGGAGCTGGGGTGA
HKR432547 RBdS081G03 pGCAP10 NM_001077268.1  
GGGAGCTGGGGTGAGGGTCCAAGGGGCCCAGGACTTGGCCGGCGTGATCTCAGCTCTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl