Prev. | 

RIKEN DNA Bank Human Resource - RITA1

Gene ID NCBI Gene 84934 |  KEGG hsa:84934
Gene Symbol RITA1
Protein Name RBPJ interacting and tubulin associated 1
Synonyms C12orf52|RITA
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084182 IRAL010H14 pOTB7 BC022092 NM_032848 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047332 ARe18F12 pKA1U5 NM_032848.1  
GGGGTTTCTGGATTCGCGGGCCGTTCACACGNTACCNTGATGCCGGCTCCTCGGGTGAGT
HKR078522 ARe96F02 pKA1U5 NM_032848.1  
GGGTTGCTGGGTGCTAAGTGCTGGGTTCTGGGTTTCTGGATTCGCGGGCCGTTCACACGT
HKR398149 RBd95G05 pGCAP10 NM_032848.1  
GGTAGGTGCGGTGACCACGTGACCTCCGCTGAGCTTTCGCCAGTGCCTGCGGCCCTCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl