Prev. |  KEGG KO K15381 > 

RIKEN DNA Bank Human Resource - SLC49A4

Gene ID NCBI Gene 84925 |  KEGG hsa:84925
Gene Symbol SLC49A4
Protein Name solute carrier family 49 member 4
Synonyms DIRC2|RCC4
Ortholog resource in our bank

  SLC49A4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033976 IRAK084P16 pCMV-SPORT6 BC039821 NM_032839 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015448 W01A038K08 pENTR-TOPO IRAK084P16 BC039821 NM_032839  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218316 ARiS045N04 pGCAP10 NM_032839.2  
GGGTCCGGAGGCCGAGGGCGACCACAGCAGCCTCCGCCTCCTGCTGCTCCGGACTATTCT
HKR322005 RBb05A05 pKA1U5 NM_032839.2  
GGGACTGCGCCCGGCAGTGGCTTCGCGGGCGACGCGTCGCCATGGGCTCTCGCTGGAGCA
HKR336902 RBb42E06 pGCAP1 NM_032839.2  
GGGACTATTCTGCGCTGGGCTAGTCGGCGGTGACCCGGACTGCGCCCGGCAGTGGCTTCG
HKR416145 RBdS040G01 pGCAP10 NM_032839.2  
GGCGGCTGGGCTAGTCGGCGGTGACCCGGACTGCGCCCGGCAGTGGCTTCGCGGGCGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl