Prev. |  KEGG KO K14548 > 

RIKEN DNA Bank Human Resource - UTP4

Gene ID NCBI Gene 84916 |  KEGG hsa:84916
Gene Symbol UTP4
Protein Name UTP4 small subunit processome component
Synonyms CIRH1A|CIRHIN|NAIC|TEX292
Ortholog resource in our bank

  UTP4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19461 F/H-Cirhin-pcDNA3 Expression vector of human UTP4/CIRHIN tagged with FLAG- and HA-tags at N-terminus.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001363 IRAK003G19 pCMV-SPORT6 BC000167 NM_032830 Partial/var
HGY090662 IRAL026K22 pOTB7 BC009348 NM_032830 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE008186 W01A020H18 pENTR-TOPO IRAL026K22 BC009348 NM_032830  
HGE008192 W01A020H24 pENTR-TOPO IRAL026K22 BC009348 NM_032830  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052523 ARe31F03 pKA1U5 NM_032830.2  
GGGAGAGAGGCGAGCACCGGGAAGGGGAGCGTGGGGCCGCTGGAATGGGTGAATTTAAGG
HKR065308 ARe63E12 pKA1U5 NM_032830.2  
GACGTGGGGCCGGGGCGGAGAGAGGCGAGCACCGGGTAAGGGGAGCGTGGGGCCGCTGGA
HKR346129 RBb65F09 pGCAP1 NM_032830.2  
GAGAGCGCGCGCGCACGTGGGGCCGGGGCGGAGAGAGGCGAGCATCGGGAAGGGGAGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.20

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl