Prev. | 

RIKEN DNA Bank Human Resource - FAM136A

Gene ID NCBI Gene 84908 |  KEGG hsa:84908
Gene Symbol FAM136A
Protein Name family with sequence similarity 136 member A
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY093948 IRAL034O12 pOTB7 BC014975 NM_032822 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070899 ARe77E03 pKA1U5 NM_032822.2  
GGGGGCAGCGCGGGGTCGCCATGGCTGAGCTGCAGNAGCTCCGGGTGCAGGAGGCGGTGG
HKR247268 ARiS118C20 pGCAP10 NM_032822.2  
GACGCCGATTCCATATGGGCGCCGGCGCGGAGCGCCGCGGGGCAGCGCGGGGTCGCCATG
HKR277719 ARiS194E23 pGCAP10 NM_032822.2  
GGTACNCCNATTCCATATGGGCGCCGGCGCGGAGCGCCGCGGGGCAGCGCGGGGTCGCCA
HKR324828 RBb12B04 pKA1U5 NM_032822.2  
GGGGGCAGCGCGGGGTCGCCATGGCTGAGCTGCAGCAGCTCCGGGTGCAGGAGGCGGTGG
HKR365305 RBd13E09 pGCAP10 NM_032822.2  
GGCGGGGCAGCGCGGGGTCGCCATGGCTGAGCTGCAGCAGCTCCGGGTGCAGGAGGCGGT
HKR393632 RBd84B08 pGCAP10 NM_032822.2  
GAGCGCGGGGTCGCCATGGCTGAGCTGCAGCAGCTCCGGGTGCAGGAGGCGGTGGAGTCC
HKR402875 RBdS007D03 pGCAP10 NM_032822.2  
GATGGGCGCCGGCGCGGAGCGCCGCGGGGCAGCGCGGGGTCGCCATGGCTGAGCTGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl