Prev. | 

RIKEN DNA Bank Human Resource - ATAD1

Gene ID NCBI Gene 84896 |  KEGG hsa:84896
Gene Symbol ATAD1
Protein Name ATPase family AAA domain containing 1
Synonyms AFDC1|FNP001|HKPX4|Msp1|THORASE
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053767 IRAK134G23 pCMV-SPORT6 BC063530 NM_032810 Partial
HGX069914 IRAK174N02 pCMV-SPORT6 BC073998 NM_032810 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE082009 M01C005A09 pDONR221 04-134-2_3-A05 AK075223 NM_032810  
HGE082057 M01C005C09 pDONR221 04-134-2_3-A05 AK075223 NM_032810  
HGE082105 M01C005E09 pDONR221 04-134-2_3-A05 AK075223 NM_032810  
HGE082011 M01C005A11 pDONR221 04-134-2_3-A06 AK075223 NM_032810  
HGE082059 M01C005C11 pDONR221 04-134-2_3-A06 AK075223 NM_032810  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243743 ARiS109F23 pGCAP10 NM_032810.2  
GACTTGCTCTTGCTGTTTCTGCCCCTGGGTTAACATTCAAGATGGTACATGCTGAAGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl