Prev. |  KEGG KO K23533 > 

RIKEN DNA Bank Human Resource - LINGO1

Gene ID NCBI Gene 84894 |  KEGG hsa:84894
Gene Symbol LINGO1
Protein Name leucine rich repeat and Ig domain containing 1
Synonyms LERN1|LRRN6A|MRT64|UNQ201
Ortholog resource in our bank

  LINGO1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19916 LINGO1 Gateway entry vector of leucine rich repeat and Ig domain containing 1 (LINGO1)

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005129 IRAK012N17 pCMV-SPORT6 BC011057 NM_032808 Full
HGY066862 IRAK167C14 pBluescriptR BC068558 NM_032808 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE091632 M01C029B08 pDONR221 MGC04-D04 BC011057 NM_032808  
HGE091680 M01C029D08 pDONR221 MGC04-D04 BC011057 NM_032808  
HGE091728 M01C029F08 pDONR221 MGC04-D04 BC011057 NM_032808  
HGE091776 M01C029H08 pDONR221 MGC04-D04 BC011057 NM_032808  
HGE091824 M01C029J08 pDONR221 MGC04-D04 BC011057 NM_032808  
HGE091872 M01C029L08 pDONR221 MGC04-D04 BC011057 NM_032808  
HGE091920 M01C029N08 pDONR221 MGC04-D04 BC011057 NM_032808  
HGE091968 M01C029P08 pDONR221 MGC04-D04 BC011057 NM_032808  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR428218 RBdS070J02 pGCAP10 NM_032808.5  
GAGGCCGCGGCCCCGCCTCACCCTTACCTGCAGCTGCAGCCCCGACGACTTGCAGCAAGT
HKR428281 RBdS070L17 pGCAP10 NM_032808.5  
GAGGCCGCGGCCCCGCCTCACCCTTACCTGCAGCTGCAGCCCCGACGACTTGCAGCAAGT
HKR428384 RBdS070P24 pGCAP10 NM_032808.5  
GAGGCCGCGGCCCCGCCTCACCCTTACCTGCAGCTGCAGCCCCGACGACTTGCAGCAAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.26

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl