Prev. |  KEGG KO K18207 > 

RIKEN DNA Bank Human Resource - POMGNT2

Gene ID NCBI Gene 84892 |  KEGG hsa:84892
Gene Symbol POMGNT2
Protein Name protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)
Synonyms AGO61|C3orf39|GTDC2|MDDGA8|MDDGC8
Ortholog resources KEGG ortholog (KEGG orthology K18207) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY053231 IRAK133B07 pBluescript BC060861 NM_032806

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR366976 RBd17H08 pGCAP10 NM_032806.4  
GACGGCGGGCACCTGCGAGCCTGGAGGTGGCGGTCGCTGCGAACCCGGCGGCGCGGCCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl