Prev. | 

RIKEN DNA Bank Human Resource - C1orf198

Gene ID NCBI Gene 84886 |  KEGG hsa:84886
Gene Symbol C1orf198
Protein Name chromosome 1 open reading frame 198
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056047 IRAK140B23 pCMV-SPORT6 BC066649 NM_032800 Full
HGY085624 IRAL014A24 pOTB7 BC004870 NM_032800

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096030 M01C040B06 pDONR221 MGC09-H03 BC066649 NM_032800  
HGE096078 M01C040D06 pDONR221 MGC09-H03 BC066649 NM_032800  
HGE096126 M01C040F06 pDONR221 MGC09-H03 BC066649 NM_032800  
HGE096174 M01C040H06 pDONR221 MGC09-H03 BC066649 NM_032800  
HGE096222 M01C040J06 pDONR221 MGC09-H03 BC066649 NM_032800  
HGE096270 M01C040L06 pDONR221 MGC09-H03 BC066649 NM_032800  
HGE096318 M01C040N06 pDONR221 MGC09-H03 BC066649 NM_032800  
HGE096366 M01C040P06 pDONR221 MGC09-H03 BC066649 NM_032800  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR381705 RBd54E09 pGCAP10 NM_032800.1  
GAGGCCGGGCATGGCGTCCATGGCGGCGGCGATCGCGGCTTCGCNCTCGGCGGTCATGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl