Prev. |  KEGG KO K11539 > 

RIKEN DNA Bank Human Resource - CBR4

Gene ID NCBI Gene 84869 |  KEGG hsa:84869
Gene Symbol CBR4
Protein Name carbonyl reductase 4
Synonyms SDR45C1
Ortholog resource in our bank

  CBR4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027931 IRAK069N19 pCMV-SPORT6 BC033650 NM_032783 Full
HGY089813 IRAL024I21 pOTB7 BC021973 NM_032783 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR260060 ARiS150C12 pGCAP10 NM_032783.3  
TGATTTANTATTGTGCGGCTGCAGGAGGTGTCGAGCGGCGTTATTTTTTTTTGCGGTTTG
HKR362825 RBd07B01 pGCAP10 NM_032783.3  
GATTGTGTGCGGCTGCAGGAGGTGTCGAGCGGCGTTATTTTTTTTTGCGGTTTGCCTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl