Prev. | 

RIKEN DNA Bank Human Resource - ZNF503

Gene ID NCBI Gene 84858 |  KEGG hsa:84858
Gene Symbol ZNF503
Protein Name zinc finger protein 503
Synonyms NOLZ-1|NOLZ1|Nlz2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084634 IRAL011J18 pOTB7 BC013011 NM_032772 Full/var
HGY086188 IRAL015H20 pOTB7 BC011625 NM_032772
HGY089770 IRAL024H02 pOTB7 BC021165 NM_032772 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235142 ARiS087O06 pGCAP10 NM_032772.4  
GGAAGTGAGTTTCCTCGCCAGAGCCCCGGCTGGACACGCAGCGGCTCGCATCGCAGAGCG
HKR470866 RBdS177C18 pGCAP10 NM_032772.4  
GCCCGGCTGGACACGCAGCGGCTCGCATCGCAGAGCGCAGCGCCGGCGCGGGGCCGCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl