Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ABHD14B

Gene ID (NCBI) 84836
Gene Symbol ABHD14B
Protein Name abhydrolase domain containing 14B
Synonyms CIB|HEL-S-299
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K13706)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX044190 IRAK110H22 pCMV-SPORT6 BC050650 NM_032750 Full
HGX047845 IRAK119K05 pCMV-SPORT6 BC056411 NM_032750 Full
HGY088811 IRAL022A11 pOTB7 BC007234 NM_032750
HGY103265 IRAL058C17 pOTB7 BC071931 NM_032750 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166401 ARi16A01 pGCAP10 NM_032750.2  
ACCGCCAGCACGCGCCTGCTTCCCGTCTGCGCGAGTCCACGCAGCTCCCCAGGCCCTTCA
HKR441982 RBdS104P22 pGCAP10 NM_032750.2  
GGGTCACCGCCAGCACGCGCCTGCTTCCCGTCTGCGCGAGTCCACGCAGCTCCCCAGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl