Prev. |  KEGG KO K13706 > 

RIKEN DNA Bank Human Resource - ABHD14B

Gene ID NCBI Gene 84836 |  KEGG hsa:84836
Gene Symbol ABHD14B
Protein Name abhydrolase domain containing 14B
Synonyms CIB|HEL-S-299
Ortholog resource in our bank

  ABHD14B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044190 IRAK110H22 pCMV-SPORT6 BC050650 NM_032750 Full
HGX047845 IRAK119K05 pCMV-SPORT6 BC056411 NM_032750 Full
HGY088811 IRAL022A11 pOTB7 BC007234 NM_032750
HGY103265 IRAL058C17 pOTB7 BC071931 NM_032750 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166401 ARi16A01 pGCAP10 NM_032750.2  
ACCGCCAGCACGCGCCTGCTTCCCGTCTGCGCGAGTCCACGCAGCTCCCCAGGCCCTTCA
HKR441982 RBdS104P22 pGCAP10 NM_032750.2  
GGGTCACCGCCAGCACGCGCCTGCTTCCCGTCTGCGCGAGTCCACGCAGCTCCCCAGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl