Prev. |  KEGG KO K07611 > 

RIKEN DNA Bank Human Resource - LMNB2

Gene ID NCBI Gene 84823 |  KEGG hsa:84823
Gene Symbol LMNB2
Protein Name lamin B2
Synonyms EPM9|LAMB2|LMN2
Featured content Apoptosis - human
Ortholog resource in our bank

  LMNB2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080825 IRAL002B01 pOTB7 BC006513 NM_032737
HGY090338 IRAL025O02 pOTB7 BC009267 NM_032737

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE016149 W01A040G05 pENTR-TOPO IRAL002H02 BC006551 NM_032737 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR247269 ARiS118C21 pGCAP10 NM_032737.2  
GGTGGCNNTNNNCGGCNCCNTNTTGNAGCCGGCGGCGCGGATTGAATGANCCCGCCGAGC
HKR382880 RBd57D08 pGCAP10 NM_032737.4 done
GGTCGGGAGCAGCGCAGGCCGCGAGCCGCCGCCACCATGGCCACNNNGCTGCCCGGCCGC
HKR433346 RBdS083G02 pGCAP10 NM_032737.2 done
GGCAGCCGGCGGCGCGGATTGAATGAGCCCGCCGAGCCCGGGCCGCCGTCGGGAGCAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl