Prev. | 

RIKEN DNA Bank Human Resource - LINC00467

Gene ID NCBI Gene 84791 |  KEGG hsa:84791
Gene Symbol LINC00467
Protein Name long intergenic non-protein coding RNA 467
Synonyms C1orf97
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088565 IRAL021G21 pDNR-LIB BC005997 NM_032705 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388179 RBd70H11 pGCAP10 XR_040059.1  
GGCGGTCGGGCGTTGGGTTTCGCGGCGCTCGCCGCACTGGTTGTTCAGCACCTTCGGTCC
HKR396569 RBd91H01 pGCAP10 XR_040059.1  
GACTGGTTGTTCAGCACCTTCGGTCCGGTTGAGGTTGTCAAGTCGGACCAAACAGGTTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl