Prev. |  KEGG KO K21443 > 

RIKEN DNA Bank Human Resource - PSRC1

Gene ID NCBI Gene 84722 |  KEGG hsa:84722
Gene Symbol PSRC1
Protein Name proline and serine rich coiled-coil 1
Synonyms DDA3|FP3214
Ortholog resource in our bank

  PSRC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX047936 IRAK119N24 pCMV-SPORT6 BC056909 NM_001032290 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR342549 RBb56G05 pGCAP1 NM_001005290.1  
TGGCCCGGGCACTAGGTTGCGGGAGAAAGCCTGTTGCGTGGAAGATAAGGCGGCGCGGGA
HKR390450 RBd76C02 pGCAP10 NM_001005290.1  
GAGGTTGCGGGAGAAAGCCTGTTGCGTGGAAGATAAGGCGGCGCGGGAAGTGGACACAGG
HKR403071 RBdS007L07 pGCAP10 NM_001005290.1  
GAGATTCGAAAGGAGCCCCGCCCCCTCGGAGCTGATTCCCGGGACTAGGTTGCGGGAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl